Snippets Collections
contract SimpleBank {
    mapping(address => uint) balances;
    
    function withdraw(uint _amount) public {
        require(balances[msg.sender] >= _amount);
        msg.sender.call.value(_amount)();
        balances[msg.sender] -= _amount;
    }
}
FROM openjdk:11-jdk
COPY HelloWorld.java .
RUN javac HelloWorld.java
CMD java HelloWorld
# By comparing itself
def is_nan(val):
  return val != val

nan_value = float("nan")
print(is_nan(nan_value))
# -> True

#Using math.isnan(Import math before using math.isnan)
import math

nan_value = float("NaN")
check_nan = math.isnan(nan_value)
print(check_nan)
# -> True
export PATH="$PATH:/Applications/Visual Studio Code.app/Contents/Resources/app/bin"
#include <stdio.h>
#include <stdlib.h>
struct node
{
   int data;
   struct node *next;
}*front=NULL,*rear=NULL;
void enqu(int x)
{

    struct node *t;
    t=(struct node*)malloc(sizeof(struct node));
    if(t==NULL)
        printf("queue is full");
    else
    {
         t->data=x;
         t->next=NULL;
        if(front==NULL)
             front=rear=t;
        else
        {
            rear->next=t;
            rear=t;
        }
    }
}
int deque()
{
    int x=-1;
    struct node *t;
    if(front==NULL)
        printf("queue i empty");
    else
    {
        t=front;
        x=t->data;
        front=front->next;
        free(t);
    }
    return x;
}
int qempty()
{
    return front==NULL;
}
void bfs(int g[][7],int i,int n)
{
   int v[7]={0};
   v[i]=1;
   printf("%d",i);
   enqu(i);
   while(!qempty())
   {
       int x=deque();
       for(int j=1;j<n;j++)
       {
           if(g[x][j]==1 &&v[j]==0)
           {
               printf("%d ",j);
               v[j]=1;
               enqu(j);
           }
       }
   }
}
void dfs(int g[][7],int i,int n)
{

    static int v[7]={0};
    printf("%d ",i);
    v[i]=1;
    for(int j=1;j<n;j++)
    {
        if(g[i][j]==1 && v[j]==0)
            dfs(g,j,n);
    }
}
int main()
{
   int g[7][7]={{0,0,0,0,0,0,0},
                {0,0,1,1,0,0,0},
                {0,1,0,0,1,0,0},
                {0,1,0,0,1,0,0},
                {0,0,1,1,0,1,1},
                {0,0,0,0,1,0,0},
                {0,0,0,0,1,0,0}};
      dfs(g,1,7);
}


document.addEventListener('DOMContentLoaded', function(){    (function(){        let sr = document.querySelectorAll('.my-star');        let i = 0;        //loop through stars        while (i < sr.length){            //attach click event            sr[i].addEventListener('click', function(){                //current star                let cs = parseInt(this.getAttribute("data-star"));                //output current clicked star value                document.querySelector('#output').value = cs;            })//end of click event            i++;        }//end of while loop    })();//end of function})
  let arr=[
    {first:"bhushan",age:2},
     {first:"shan",age:22},
      {first:"bhu",age:29},
      
    ];
    
    //taask ::to print first elemtn of object
    
    
    arr.forEach(function(arr){
        console.log(arr.first);
        
    }
        )
import { Component, Directive, Input, HostListener, Inject, Injectable, OnInit } from '@angular/core'
import { TimeZoneService } from './time-zone.service';
import moment from 'moment-timezone';
import { Moment } from 'moment';

import 'moment-range';
import 'moment/locale/fr';
import 'moment/locale/es';
import 'moment/locale/de';
import 'moment/locale/en-gb';
import 'moment/locale/ar';
import 'moment/locale/hi';

@Component({
  selector: 'app',
  template: `
  <div>
    <form #f="ngForm">
      <div class="form-group">
        <label>Select tenant/device time zone: </label>
        <select name="timeZone" [ngModel]="selectedTz" (ngModelChange)="timeZoneChanged($event)">
          <option *ngFor="let tz of tzNames" [value]="tz">
            {{ tz }}
          </option>
        </select><span> {{ tzNames.length }}</span>
      </div>
      <div class="form-group">
        <label>Select locale: </label>
        <select name="locale" [ngModel]="selectedLocale" (ngModelChange)="changeLocale($event)">
          <option *ngFor="let locale of locales" [value]="locale">
            {{ locale }}
          </option>
        </select>
      </div>

      <div class="form-group">
        <label>Select display time zone: </label>   
        <select name="displayTimeZone" [ngModel]="displayTz" (ngModelChange)="changeDisplayTz($event)">
          <option [value]="selectedTz">Tenant/Device</option>
          <option [value]="userTz">User</option>
          <option [value]="utcTz">UTC</option>
        </select>
      </div>
    </form>
  </div>
  <br/>
  <div>Tenant/Device time zone: <strong>{{ selectedTz }}</strong></div>
  <div>User's time zone: <strong>{{ userTz }}</strong></div>
  <br/>
  <div>UTC Date: {{ date }}</div>
  <br/>
  <div>Date displayed in: <strong>{{ displayTz }}</strong></div>
  <div>Unformated: <strong>{{ a }}</strong></div>
  <div>Formated: <strong>{{ aFormat }}</strong></div>
  <div>Date formated: <strong>{{ aDateFormat }}</strong></div>
  <div>Time formated: <strong>{{ aTimeFormat }}</strong></div>
  <div>Special format: <strong>{{ aSpecialFormat }}</strong></div>
  <br/>
  <div>
    <div *ngFor="let form of allFormats">
      {{ formats(form) }}
    </div>
 </div>
 <br/>
 <div>
   <div>Tenant from UTC: {{ tenantDateTime }}</div>
   <div>UTC from Tenant: {{ utcDateTime }}</div>
   <div>Formatted tenant from UTC: {{ tenantDateTimeFormatted }}</div>
 </div>
`
})
export class AppComponent {
  public tzNames: string[];

  public userTz: string;
  public selectedTz: string;
  public utcTz: string;
  public displayTz: string;

  public selectedLocale: string;

  public date: moment.Moment;
  public fromNow: string;

  public a: moment.Moment;
  public aFormat: string;
  public aUtcFormat: string;
  public aDateFormat: string;
  public aTimeFormat: string;
  public aSpecialFormat: string;

  public tenantDateTime: Moment;
  public tenantDateTimeFormatted: Moment;

  public utcDateTime: Moment;

  private format = 'LLL Z z';
  private dateFormat = 'L';
  private timeFormat = 'LTS';

  private allFormats = [
    'LT',  // 12:32 PM
    'LT (UTC Z)',  // 12:32 PM -08:00
    'LTS', // 12:32:18 PM
    'LTS (UTC Z)', // 12:32:18 PM -08:00
    'HH:mm:ss.SSS',
    'HH:mm:ss.SSS (UTC Z)',
    'L',   // 10/05/2018
    'LL',  // October 5, 2018
    'LLL', // October 5, 2018 12:32 PM
    'LLL (UTC Z)',  // 12:32 PM -08:00
    'LLLL',// Friday, October 5, 2018 12:32 PM
    'LLLL (UTC Z)'
  ]

  private num = 1679024676000;

  private locales = [
    'ar',
    'en',
    'en-gb',
    'fr',
    'es',
    'de',
    'hi'
  ];

  private abbrs = {
    EST: 'Eastern Standard Time',
    EDT: 'Eastern Daylight Time',
    CST: 'Central Standard Time',
    CDT: 'Central Daylight Time',
    MST: 'Mountain Standard Time',
    MDT: 'Mountain Daylight Time',
    PST: 'Pacific Standard Time',
    PDT: 'Pacific Daylight Time',
    '+0330': 'Iran'
  };

  //only for visuals
  constructor(
    @Inject('TimeZoneService') private timeZoneService: TimeZoneService
  ) {
    this.userTz = moment.tz.guess();
    this.utcTz = 'UTC'
    this.tzNames = moment.tz.names();


    this.timeZoneChanged('America/New_York');
    this.changeLocale('en');
  }

  public timeZoneChanged(timeZone: string): void {
    console.log(timeZone);
    this.selectedTz = timeZone;

    this.updateTime(timeZone);
  }

  public changeDisplayTz(displayTz: string): void {
    console.log(displayTz);
    this.updateTime(displayTz);
  }

  public changeLocale(locale: string) {
    this.selectedLocale = locale;
    moment.locale(this.selectedLocale);
    this.updateTime(this.selectedTz);
  }

  public formats(format: string): string {
    return this.a.format(format);
  }

  getTimezoneOffset(tz, hereDate) {
    // hereDate = new Date(hereDate || Date.now());
    hereDate.setMilliseconds(0); // for nice rounding
    const hereOffsetHrs = hereDate.getTimezoneOffset() / 60 * -1,
    thereLocaleStr = hereDate.toLocaleString('en-US', {timeZone: tz}),
    thereDate = new Date(thereLocaleStr),
    diffHrs = (thereDate.getTime() - hereDate.getTime()) / 1000 / 60 / 60,
    thereOffsetHrs = hereOffsetHrs + diffHrs;
    var b = (thereOffsetHrs - Math.floor(thereOffsetHrs)) * 60;
    console.log(hereOffsetHrs + ' '+ diffHrs + ' '+ b);
    // console.log(tz, thereDate, 'UTC'+(thereOffsetHrs < 0 ? '' : '+')+thereOffsetHrs);
    return 'UTC '+(thereOffsetHrs < 0 ? '' : '+')+Math.floor(thereOffsetHrs)+':'+b;
}

  private updateTime(timeZone: string) {
    this.displayTz = timeZone;

    this.date = moment(this.num).utc();
    this.fromNow = this.date.fromNow();

    this.a = moment(this.num).tz(timeZone);
    const d = new Date();
    console.log(moment(d.getTime()).tz(timeZone).format('YYYY-MM-DD HH:mm'))
    console.log(Intl.DateTimeFormat().resolvedOptions().timeZone);
    console.log(this.getTimezoneOffset(timeZone, d))

    this.aFormat = this.a.format(this.format); // 2013-11-18T19:55:00+08:00
    this.aDateFormat = this.a.format(this.dateFormat);
    this.aTimeFormat = this.a.format(this.timeFormat);
    this.aSpecialFormat = this.applySpecialFormat(this.a);

    this.timeZoneService.setTenantTimeZone(this.selectedTz);
    this.tenantDateTime = this.timeZoneService.utcToTenant(this.date);
    this.utcDateTime = this.timeZoneService.tenantToUtc(this.tenantDateTime);
    this.tenantDateTimeFormatted = this.timeZoneService.utcToTenantString(this.date, 'LLL');
  }

  private applySpecialFormat(dateTime: moment.Moment): string {
    let special = dateTime.format('llll');
    let offset = dateTime.utcOffset();
    return special + ' ' + dateTime.tz();
  }
}
#include <stdio.h>
#include <stdlib.h>
struct node
{
   int data;
   struct node *next;
}*front=NULL,*rear=NULL;
void enqu(int x)
{

    struct node *t;
    t=(struct node*)malloc(sizeof(struct node));
    if(t==NULL)
        printf("queue is full");
    else
    {
         t->data=x;
         t->next=NULL;
        if(front==NULL)
             front=rear=t;
        else
        {
            rear->next=t;
            rear=t;
        }
    }
}
int deque()
{
    int x=-1;
    struct node *t;
    if(front==NULL)
        printf("queue i empty");
    else
    {
        t=front;
        x=t->data;
        front=front->next;
        free(t);
    }
    return x;
}
int qempty()
{
    return front==NULL;
}
void bfs(int g[][7],int i,int n)
{
   int v[7]={0};
   v[i]=1;
   printf("%d",i);
   enqu(i);
   while(!qempty())
   {
       int x=deque();
       for(int j=1;j<n;j++)
       {
           if(g[x][j]==1 &&v[j]==0)
           {
               printf("%d ",j);
               v[j]=1;
               enqu(j);
           }
       }
   }
}
int main()
{
   int g[7][7]={{0,0,0,0,0,0,0},
                {0,0,1,1,0,0,0},
                {0,1,0,0,1,0,0},
                {0,1,0,0,1,0,0},
                {0,0,1,1,0,1,1},
                {0,0,0,0,1,0,0},
                {0,0,0,0,1,0,0}};
      bfs(g,4,7);
}


sudo apt-get install valgrind
#include <bits/stdc++.h>

using namespace std;
int l[1000][1000] , a[1000][1000] , n , m;
vector <pair<int , int>> kq;
void qhd()
{
    for (int i = 1; i <= n; i++)
        for (int j = 1; j <= m; j++)
        if (a[i][j] == 1) l[i][j] = l[i - 1][j - 1] + 1;
        else l[i][j] = max(l[i - 1][j] , l[i][j - 1]);
    cout << l[n][m] << endl;
    int i = n , j = m;
    while ((i > 0) && (j > 0))
    if (a[i][j] == 1)
    {
        kq.push_back({i , j});
        i--; j--;
    } else if (l[i - 1][j] > l[i][j - 1]) i--;
           else j--;
}
int main()
{
    freopen ("f.inp" , "r" , stdin);
    freopen ("f.out" , "w" , stdout);
    cin >> n >> m;
    int u , v;
    while (cin >> u >> v)
    {
        a[u][v] = 1;
        a[v][u] = 1;
    }
    qhd();
    reverse (kq.begin() , kq.end());
    for (auto x : kq)
    cout << x.first << " " << x.second << endl;
    return 0;
}
#include <bits/stdc++.h>

using namespace std;
int n , m , a[1000][1000] , f[1000][1000] , maxx = -1;
void truyvet()
{
    vector <pair<int , int>> kq;
    int vx , vy = m , ii;
    for (int i = 1; i <= n; i++)
    if (f[i][m] > maxx)
    {
        vx = i;
        maxx = f[i][m];
    }
    ii = vx;
    cout << maxx << endl;
    while (vy > 1)
    {
        if (f[vx][vy - 1] > max(f[vx + 1][vy - 1] , f[vx - 1][vy - 1]))
        {
            vy--;
            kq.push_back({vx , vy});
        }
        if (f[vx - 1][vy - 1] > max(f[vx][vy - 1] , f[vx + 1][vy - 1]))
        {
            vx--;
            vy--;
            kq.push_back({vx , vy});
        }
        if (f[vx + 1][vy - 1] > max(f[vx - 1][vy - 1] , f[vx][vy - 1]))
        {
            vx++;
            vy--;
            kq.push_back({vx , vy});
        }
    }
    reverse (kq.begin() , kq.end());
    for (auto x : kq)
    cout << x.first << " " << x.second << endl;
    cout << ii << " " << m << endl;
}
int main()
{
    freopen ("f.inp" , "r" , stdin);
    freopen ("f.out" , "w" , stdout);
    cin >> n >> m;
    for (int i = 1; i <= n; i++)
       for (int j = 1; j <= m; j++)
       cin >> a[i][j];
    memset (f , 0 , sizeof f);
    for (int j = 1; j <= m; j++)
        for (int i = 1; i <= n; i++)
            f[i][j] = max(f[i][j - 1] + a[i][j] , max(f[i + 1][j - 1] + a[i][j] , f[i - 1][j - 1] + a[i][j]));
    truyvet();
    return 0;
}
#include<bits/stdc++.h>

void mkadj(unordered_map<int, set<int>> &mp, vector<vector<int>> &edges)
{
    for(int i=0;i<edges.size();i++)
    {
        int u = edges[i][0];
        int v = edges[i][1];

        mp[u].insert(v);
        mp[v].insert(u);
    }
}

void dfs(unordered_map<int, set<int>> &mp, unordered_map<int, bool> &visited, vector<int> &comp, int node)
{
    comp.push_back(node);
    visited[node]=true;
    for(auto x:mp[node])
    {
        if(!visited[x]) dfs(mp, visited, comp, x);
    }
}

vector<vector<int>> depthFirstSearch(int V, int E, vector<vector<int>> &edges)
{
    unordered_map<int, set<int>> mp;
    unordered_map<int, bool> visited;
    mkadj(mp, edges);
   
    vector<vector<int>> ans;
    
    for(int i=0;i<V;i++)
    {
        if(!visited[i])
        {
            vector<int> comp;
            dfs(mp, visited, comp, i);
            ans.push_back(comp);
        }

    }
    return ans;
    // Write your code here
}
As written in font awesome documentation, you can easily use it like this:
First, install the package by:

npm install @fortawesome/fontawesome-svg-core
npm install @fortawesome/free-solid-svg-icons
npm install @fortawesome/react-fontawesome

Then you can use it like this:

Then you can use it like this:

  // Light:
  <FontAwesomeIcon icon={["fal", "coffee"]} />
  // Regular:
  <FontAwesomeIcon icon={["far", "coffee"]} />
  // Solid
  <FontAwesomeIcon icon={["fas", "coffee"]} />
  // ...or, omit as FontAwesome defaults to solid, so no need to prefix:
  <FontAwesomeIcon icon="coffee" />
  // Brand:
  <FontAwesomeIcon icon={["fab", "github"]} />
You can also use it like this:

import { FontAwesomeIcon } from '@fortawesome/react-fontawesome'
import { faCoffee } from '@fortawesome/free-solid-svg-icons'

const element = <FontAwesomeIcon icon={faCoffee} />
Sizing:

  <FontAwesomeIcon icon="coffee" size="xs" />
  <FontAwesomeIcon icon="coffee" size="lg" />
  <FontAwesomeIcon icon="coffee" size="6x" />
import { i18n } from 'meteor/universe:i18n';

import SimpleSchema from 'simpl-schema';

import ModuleTypes from '../subTypes';

export default {
  available: true,
  price: () => 25,
  type: ModuleTypes.CONSUMER,
  settings: new SimpleSchema({
    minDuration: {
      label: () => i18n.__('modules.reservations.settings.minDuration'),
      type: SimpleSchema.Integer,
      defaultValue: 30, // Minutes
      min: 0,
    },
    maxDuration: {
      label: () => i18n.__('modules.reservations.settings.maxDuration'),
      type: SimpleSchema.Integer,
      defaultValue: 600, // Minutes
      optional: true,
      min: 1,
    },
    durationGranularity: {
      label: () => i18n.__('modules.reservations.settings.durationGranularity.label'),
      type: SimpleSchema.Integer,
      defaultValue: 30, // Minutes
      optional: true,
      min: 1,
      max: 30,
      uniforms: {
        options: () =>
          new Array(60 / 5 + 1).fill(0).map((_, i) => {
            const n = i * 5 || 1;

            return {
              label: `${n} ${i18n.__(`modules.reservations.settings.durationGranularity.${i === 1 ? 'minute' : 'minutes'}`)}`,
              value: n,
            };
          }),
      },
    },
    Capacity: {
      label: () => i18n.__('modules.reservations.settings.capacity'),
      type: SimpleSchema.Integer,
      defaultValue: 1, // number of reservations
      optional: true,
      min: 0,
    },
    maxPeople: {
      label: () => i18n.__('modules.reservations.settings.maxPeople'),
      type: SimpleSchema.Integer,
      defaultValue: 12,
      min: 1,
    },
    minPeople: {
      label: () => i18n.__('modules.reservations.settings.minPeople'),
      type: SimpleSchema.Integer,
      defaultValue: 1,
      optional: true,
      min: 1,
    },
    minStartDate: {
      label: () => i18n.__('modules.reservations.settings.minStartDate'),
      type: SimpleSchema.Integer,
      defaultValue: 20, // Minutes
      optional: true,
      min: 0,
    },
    maxStartDate: {
      label: () => i18n.__('modules.reservations.settings.maxStartDate'),
      type: SimpleSchema.Integer,
      defaultValue: 365, // Year
      optional: true,
      min: 1,
    },
    managerIds: {
      label: () => i18n.__('modules.reservations.settings.managers'),
      type: Array,
      defaultValue: [],
      optional: true,
    },
    'managerIds.$': {
      type: String,
    },
    reminderEmailOffsetInHours: {
      helpText: () => i18n.__('modules.reservations.settings.reminderEmailOffset.help'),
      label: () => i18n.__('modules.reservations.settings.reminderEmailOffset.label'),
      type: SimpleSchema.Integer,
      defaultValue: 24,
      optional: true,
      min: -1,
      max: 31,
    },
    reservationInstructions: {
      label: () => i18n.__('modules.reservations.settings.reservationInstructions'),
      type: String,
      optional: true,
      uniforms: {
        multiline: true,
      },
    },
    approvalInstructions: {
      label: () => i18n.__('modules.reservations.settings.approvalInstructions'),
      type: String,
      optional: true,
      uniforms: {
        multiline: true,
      },
    },
  }),
};
/* eslint no-param-reassign: ["error", { "props": true, "ignorePropertyModificationsFor": ["Reservations"] }] */
import { i18n } from 'meteor/universe:i18n';
import { Meteor } from 'meteor/meteor';

import moment from 'moment-timezone';

import Tenantify from '../../lib/tenantify';
import OpeningHours from '../opening_hours';
import Interactions from '../interactions';
import ClosedDates from '../closed_dates';
import Tableplans from '../tableplans';
import Consumers from '../consumers';
import Modules from '../modules';
import Tenants from '../tenants';
import Users from '../users';

import { getDateTimeFormatter, getLegacyDateTimeFormatter } from '../../lib/timeZone';
import { escapeHTML } from '../../lib/format';

export default function (Reservations) {
  Reservations.create = function (
    { name, email, comment, duration, people, phone, date } = {},
    userId,
    consumerUrl,
    browserLocale = undefined
  ) {
    const currentDate = new Date();
    const {
      durationGranularity = 30, // In minutes
      maxStartDate = 365, // In days
      minStartDate = 20, // In minutes
      maxDuration = 600, // In minutes (10 hours)
      minDuration = 30,
      capacity = 1, // In reservations
      maxPeople = 12,
      minPeople = 1,
      managerIds = [],
      approvalInstructions = '',
    } = Modules.reservations.get().settings;

    const parsedDate = new Date(date);

    if (name.length < 1) {
      throw new Error('Name too short');
    }

    if (name.length > 80) {
      throw new Error('Name is too long (max 80)');
    }

    if (email.length < 1 || !Users.validateEmail(email)) {
      throw new Error('Invalid email');
    }

    if (email.length > 200) {
      throw new Error('Email is too long (max 200)');
    }

    if (comment && comment.length > 500) {
      throw new Error('Invalid comment length (max 500)');
    }

    if (duration > maxDuration || duration < minDuration) {
      throw new Error(`Invalid duration (${minDuration} min, ${maxDuration} max)`);
    }

    if (duration % durationGranularity !== 0) {
      throw new Error(`Invalid duration (please use steps of ${durationGranularity} mins)`);
    }

    if (people > maxPeople || people < minPeople) {
      throw new Error(`Invalid people amount (${minPeople} min, ${maxPeople} max)`);
    }

    if (Number.isNaN(parsedDate.getTime())) {
      throw new Error('Invalid date');
    }

    const timeDifference = parsedDate.getTime() - currentDate.getTime();

    if (timeDifference < 0) {
      throw new Error('Date has already passed');
    }

    if (Math.round(timeDifference / (1000 * 60 * 60 * 24)) > maxStartDate) {
      throw new Error(`The selected date is too far in the future (max ${maxStartDate}mins)`);
    }

    if (Math.round(timeDifference / (1000 * 60)) < minStartDate) {
      throw new Error(`The selected date must be ${minStartDate} minutes after the current time`);
    }

    const endDate = moment(parsedDate).add(duration, 'minutes').toDate();
    const startDate = moment(parsedDate).toDate();

    const overlappingReservations = Reservations.getOverlapping(startDate, endDate);
    const { max_nr_reservations = 10, max_nr_guests = 20 } = (() => {
      if (capacity < 1) {
        return {};
      }

      const [nrGuests, nrReservations] = Tableplans.find()
        .fetch()
        .reduce((arr, item) => [arr[0] + (item.max_nr_guests ?? 0), arr[1] + (item.max_nr_reservations ?? 0)], [0, 0]);

      return { max_nr_guests: nrGuests || 20, max_nr_reservations: nrReservations || 10 };
    })();

    if (overlappingReservations.length >= max_nr_reservations) {
      throw new Meteor.Error('reservation', 'maxReservationsOverlapping', 'Too many reservations overlapping (for this seating area)');
    }

    if (overlappingReservations.reduce((a, r) => a + (r.people ?? 0), 0) + people >= max_nr_guests) {
      throw new Meteor.Error('reservation', 'maxPersonsOverlapping', 'Max number of guests reached (for this seating area)');
    }

    if (
      OpeningHours.isClosedOn(OpeningHours.forTypes.DEFAULT, date) ||
      ClosedDates.getEntriesOn(OpeningHours.forTypes.DEFAULT, date).length > 0
    ) {
      throw new Meteor.Error('reservation', 'closed', 'Invalid requested date: tenant is closed on that date / at that time');
    }

    const reservationId = Reservations.insert({
      locale: browserLocale,
      approved: false,
      startDate,
      endDate,
      name,
      people,
      phone,
      email,
      comment,
    });

    const user = userId === false ? undefined : Consumers.findOne(userId ? { _id: userId } : { 'profile.email': email });

    if (user) {
      const interactionType = Interactions.types.RESERVATION;

      Interactions.insert({
        funnel_stage: Interactions.getFunnelStageFromType(interactionType),
        entity_id: reservationId,
        type: interactionType,
        consumer_id: user._id,
      });
    }

    const consumerReservationUrl = new URL(
      `/reservation/${reservationId}`,
      consumerUrl ?? Meteor.settings.public.consumer_url ?? 'https://mrwinston.app'
    ).toString();
    const backofficeReservationUrl = new URL(
      `/admin/reservations/approval/${reservationId}`,
      Meteor.settings.public.backoffice_url ?? 'https://backoffice.mrwinston.com'
    ).toString();

    const tenant = Tenants.findOne(Tenantify.getCurrentTenant());
    const tenantName = tenant?.companyDetails?.name ?? 'Mr. Winston';
    const managers = Users.find({ _id: { $in: managerIds } }).fetch();
    const managerEmails = managers.map((u) => u.profile.email).filter(Boolean);
    const tenantLocale = Modules.default.get().settings.locale?.language ?? 'en-US';
    const userLocale = browserLocale ?? user?.profile?.locale ?? 'en-US';

    const contactDetails = (() => {
      // eslint-disable-next-line no-shadow
      const { email, phone } = Tenants.getContactDetails(tenant);

      return email ?? phone ?? managerEmails[0] ?? 'info+reservations@mrwinston.nl';
    })();

    const mailVars = (locale, url) => {
      const { name: timeZone } = Tenants.getTimeZone(startDate);

      return {
        url,
        time:
          getDateTimeFormatter(locale, timeZone, { hour: 'numeric', minute: 'numeric' })?.format(startDate) ??
          getLegacyDateTimeFormatter(locale, timeZone, startDate).format('LT'),
        date:
          getDateTimeFormatter(locale, timeZone, { dateStyle: 'short' })?.format(startDate) ??
          getLegacyDateTimeFormatter(locale, timeZone, startDate).format('YYYY-MM-DD'),
        consumerName: name,
        tenantName,
        contactDetails,
        instructions: escapeHTML(approvalInstructions.trim()),
      };
    };

    if (!Meteor.isTest) {
      // Send mail to customer
      Meteor.call(
        'sendRichMail',
        'reservationRequested',
        email,
        mailVars(userLocale, consumerReservationUrl),
        { replyTo: managerEmails },
        userLocale
      );

      // Send mail to owner/managers
      if (managers.length > 0) {
        managers.forEach((manager) => {
          Meteor.call(
            'sendRichMail',
            'reservationPlaced',
            manager.profile.email,
            mailVars(manager.profile.locale ?? tenantLocale, backofficeReservationUrl),
            {},
            manager.profile.locale ?? tenantLocale
          );
        });
      }
    }

    return { reservationId, url: consumerReservationUrl };
  };

  Reservations.modify = function (reservationId, { name, email, comment, duration, people, phone, date, tableplanId } = {}) {
    const tableplan = Tableplans.findOne({ _id: tableplanId });
    const reservation = Reservations.findOne(reservationId);

    if (!reservation) {
      throw new Error('Reservation not found');
    }

    const currentDate = new Date();
    const {
      durationGranularity = 30, // In minutes
      maxStartDate = 365, // In days
      minStartDate = 20, // In minutes
      maxDuration = 600, // In minutes (10 hours)
      minDuration = 30,
      capacity = 1,
      maxPeople = 12,
      minPeople = 1,
    } = Modules.reservations.get().settings;

    const parsedDate = new Date(date ?? reservation.startDate);

    if (name.length < 1) {
      throw new Error('Name too short');
    }

    if (name.length > 80) {
      throw new Error('Name is too long (max 80)');
    }

    if (email.length < 1 || !Users.validateEmail(email)) {
      throw new Error('Invalid email');
    }

    if (email.length > 200) {
      throw new Error('Email is too long (max 200)');
    }

    if (comment && comment.length > 500) {
      throw new Error('Invalid comment length (max 500)');
    }

    if (duration > maxDuration || duration < minDuration) {
      throw new Error(`Invalid duration (${minDuration} min, ${maxDuration} max)`);
    }

    if (duration % durationGranularity !== 0) {
      throw new Error(`Invalid duration (please use steps of ${durationGranularity} mins)`);
    }

    if (people > maxPeople || people < minPeople) {
      throw new Error(`Invalid people amount (${minPeople} min, ${maxPeople} max)`);
    }

    if (!tableplan) {
      throw new Error('Invalid table plan');
    }

    if (date) {
      if (Number.isNaN(parsedDate.getTime())) {
        return new Error('Invalid date');
      }

      const timeDifference = parsedDate.getTime() - currentDate.getTime();

      if (timeDifference < 0) {
        return new Error('Date has already passed');
      }

      if (Math.round(timeDifference / (1000 * 60 * 60 * 24)) > maxStartDate) {
        return new Error(`The selected date is too far in the future (max ${maxStartDate}mins)`);
      }

      if (Math.round(timeDifference / (1000 * 60)) < minStartDate) {
        return new Error(`The selected date must be ${minStartDate} minutes after the current time`);
      }
    }

    const endDate = duration ? moment(parsedDate).add(duration, 'minutes').toDate() : reservation.endDate;
    const startDate = date ? moment(parsedDate).toDate() : reservation.startDate;

    const overlappingReservations = Reservations.getOverlapping(startDate, endDate);
    const { max_nr_reservations = 10, max_nr_guests = 20 } = tableplan;

    if (overlappingReservations.length >= capacity) {
      throw new Meteor.Error('reservation', 'maxReservationsOverlapping', 'Too many reservations overlapping for this seating area');
    }

    if (overlappingReservations.reduce((a, r) => a + (r.people ?? 0), 0) + people >= max_nr_guests) {
      throw new Meteor.Error('reservation', 'maxPersonsOverlapping', 'Max number of guests reached for this seating area');
    }

    return Reservations.update(
      { _id: reservation._id },
      {
        $set: {
          startDate,
          endDate,
          name,
          people,
          phone,
          email,
          comment,
          capacity,
        },
      }
    );
  };

  Reservations.switchReservation = function (currentTable, toTable, incomingReservation, overlap) {
    if (overlap) {
      const allReservationsCurrentTable = Reservations.find({ tables: currentTable._id }).fetch();
      const allReservationsToTable = Reservations.find({ tables: toTable._id }).fetch();

      allReservationsCurrentTable.forEach((currentTableReservation) => {
        const leftOverReservations = [];

        currentTableReservation.tables.forEach((table) => {
          if (table !== currentTable._id) {
            leftOverReservations.push(table);
          }
        });

        leftOverReservations.push(toTable._id);

        Reservations.update(currentTableReservation._id, { $set: { tables: leftOverReservations } });
      });

      allReservationsToTable.forEach((toTableReservation) => {
        const leftOverReservations = [];

        toTableReservation.tables.forEach((table) => {
          if (table !== toTable._id) {
            leftOverReservations.push(table);
          }
        });

        leftOverReservations.push(currentTable._id);

        Reservations.update(toTableReservation._id, { $set: { tables: leftOverReservations } });
      });
    } else {
      const tablesOnIncomingReservation = incomingReservation.tables.filter((table) => {
        return table !== currentTable._id;
      });

      tablesOnIncomingReservation.push(toTable._id);

      // from current reservation remove the currentTable and set to table
      Reservations.update(incomingReservation._id, { $set: { tables: tablesOnIncomingReservation } });
    }
  };

  Reservations.reservationOnTable = function (incomingReservation, table) {
    if (incomingReservation.tables.length !== 0) {
      const onTable = incomingReservation.tables.some((currentReservationTables) => {
        if (currentReservationTables === table._id) {
          return false;
        }

        return true;
      });

      if (!onTable) {
        return false;
      }
    }

    return false;
  };

  Reservations.checkTableTimeSlotAvailable = function (incomingReservation, table, checkOnTable = true) {
    const reservations = Reservations.find({ tables: table._id }).fetch(); // should check for today

    if (reservations.length === 0) {
      return true;
    }

    let timeSlotAvailable;

    if (checkOnTable) {
      timeSlotAvailable = Reservations.reservationOnTable(incomingReservation, table);
    }

    timeSlotAvailable = reservations.every((reservation) => {
      if (reservation._id === incomingReservation._id || !reservation.tables || reservation.tables.length === 0) {
        return true;
      }

      const rangeIncoming = moment.range(incomingReservation.startDate, incomingReservation.endDate);
      const rangeReservation = moment.range(reservation.startDate, reservation.endDate);

      // if overlaps gives back true we give back false as the timeSlots is not available.
      return !rangeIncoming.overlaps(rangeReservation);
    });

    return timeSlotAvailable;
  };

  Reservations.getTodaySelector = function (selectedDate) {
    const date =
      selectedDate ||
      moment()
        .minute(Math.ceil(moment().minute() / 15) * 15)
        .toDate();

    const startOfDay = moment(date).startOf('day').toDate();
    const endOfDay = moment(date).endOf('day').toDate();

    return {
      startDate: {
        $gte: startOfDay,
        $lte: endOfDay,
      },
    };
  };

  Reservations.assignToTable = function (reservationId, tableId) {
    Reservations.update(reservationId, { $addToSet: { tables: tableId } });
  };

  Reservations.removeFromTable = function (reservationId, tableId) {
    Reservations.update(reservationId, { $pull: { tables: tableId } });
  };

  Reservations.getOverlapping = function (startDate, endDate) {
    return Reservations.find({
      startDate: { $lt: endDate },
      endDate: { $gt: startDate },
    }).fetch();
  };

  // Returns all the reservations that fall in that hour.
  //  For example: { 12: [...], 13: [..., ...] }
  Reservations.getPerHour = function (reservations = Reservations.find().fetch()) {
    const hours = new Array(24).fill(0).map((_, i) => i);

    // {0: [], 1: [], 2: [], ...}
    const outputObj = Object.fromEntries(hours.map((hour) => [hour, []]));

    reservations.forEach((reservation) => {
      for (let i = reservation.startDate.getHours(); i <= reservation.endDate.getHours(); i++) {
        outputObj[i].push(reservation);
      }

      // If the reservation's end date is not at a round hour (it has minutes), also set the next hour
      //  For example: startDate=9:00, endDate=10:15 => { 8: [], 9: [...], 10: [...], 11: [...], 12: [] }
      if (reservation.endDate.getMinutes() > 0) {
        const nextHour = reservation.endDate.getHours() + 1;

        if (nextHour in outputObj) {
          outputObj[nextHour].push(reservation);
        }
      }
    });

    return outputObj;
  };

  Reservations.tryGetLocale = (reservation) => {
    const { language: tenantLocale } = Modules.default.get().settings?.locale ?? {};
    const consumer = Consumers.findOne({ 'profile.email': reservation?.email });

    return {
      locale: consumer?.profile?.locale ?? reservation.locale ?? tenantLocale,
      consumer,
    };
  };

  Reservations.tryGetName = (reservation) => {
    if (reservation.name) {
      return reservation.name;
    }

    const { consumer, locale } = Reservations.tryGetLocale(reservation);

    return consumer?.profile?.name ?? consumer?.username ?? i18n.__('reservations.guest', { _locale: locale });
  };
}
define( "MP_NO_MPAUTH", true );
#include <bits/stdc++.h> 

void makeAdj(unordered_map<int, set<int>>&mp1, vector<pair<int, int>> &edges)
{
    for(int i=0; i<edges.size(); i++)
    {
        int u = edges[i].first;
        int v = edges[i].second;
        mp1[u].insert(v);
        mp1[v].insert(u);
    }
}

void bfstrav(vector<int> &ans, unordered_map<int, bool> &visited, unordered_map<int, set<int>>&mp1, int node)
{
    queue<int> q;
    q.push(node);
    visited[node]=1;

    while(!q.empty())
    {
        int p=q.front();
        q.pop();

        ans.push_back(p);

        for(auto x: mp1[p])
        {
            if(!visited[x]) 
            {
                q.push(x);
                visited[x]=1;
            }
        }

    }
}


vector<int> BFS(int vertex,vector<pair<int, int>> edges)
{
    vector<int> ans;
    unordered_map<int, bool> visited;
    unordered_map<int, set<int>>mp1;
    makeAdj(mp1, edges);
    for(int i=0;i<vertex;i++)
    {
        if(!visited[i]) bfstrav(ans, visited, mp1, i);
    }
    return ans;
    // Write your code here
}
Rosalind Challenge 9: Finding a Motif in DNA
# http://rosalind.info/problems/subs/
#
#------------------------------------------------#

print("Rosalind Challenge 9: Finding a Motif in DNA\n")

s = Seq("ACAAGCTGAGTTGCTGAGTCGCTGAGTCCGCTGAGTATCGGCTGAGTACTTGCTGAGTCAGCTGAGTGCTGAGTCGCTGAGTTAATATGGCTGAGTAGCTGAGTTACTAGCTGAGTCGCTGAGTGAGCCGCTGAGTCACCGCATCGTGCATACGCTGAGTACGCGCTGAGTATGCTGAGTGCTGAGTCGGGAGGAAATAAAGCTGAGTTGCTGAGTGCTGAGTTTCTGCTGAGTGCTGAGTGCTGAGTGGCTGAGTAAGAAGCTGAGTAGTGCTGAGTTTGTCGCTGAGTGCTGAGTTCGGCTGAGTGCTGAGTGCTGAGTGCTGAGTTACAGCTGAGTAGAAAGGGGCTGAGTGCTGAGTAGCTGAGTCGTGCTGAGTCGCTGAGTGCTGAGTAGCTGAGTAGGCTGAGTAGCTGAGTGCTGAGTGCTGAGTAAGCTGAGTGTATCGGTGGCTGAGTAAGCTGAGTGCTGAGTTGCGCCGCTGAGTCGCTGAGTTGTTGCTGAGTCGCTGAGTGCTGAGTTGGCTGAGTTGAGCTGAGTCTTGCTGAGTTTCGCTGAGTGCTGAGTGCTGAGTAGAGGGGCTGAGTACTGCTGAGTGCTGAGTTGTATGCTGAGTGCTGAGTGGGCCGCTGAGTGCTGAGTGAGGGGCTGAGTGCTGAGTTGCTGAGTAGCTGAGTGCTGAGTGCTGAGTGCTGAGTGCTGAGTGCTGAGTGCTGGCTGAGTAGGCTGAGTTGCGCTGAGTGCTGAGTTGGTTTGCTGAGTAGCTGAGTGGCTGAGTATGCTGAGTTCGCTGAGTGATCCTCGGCTGAGTGCTGAGTCCGCTGAGTGGCTGAGTGCTGAGTATACTGCTGAGTGCTGAGTTGCTGAGTTTAGCTGAGTGCTGAGTGGCTGAGTAGCCTGCTGAGTGGACGGTGCTGAGTCCCAGCTGAGTAGCTGAGTGCTGAGTAGCTGAGTGGCTGAGTATTCAAGCTGAGTGCTGAGTGCTGAGTGCTGAGT")
t = Seq("GCTGAGTGC")

locations = []
count = 0
loc = 0

while (count < len(s)):
    loc = s.find(t, start=count)
    if (loc > 0):
        count = loc + 1
        locations.append(loc + 1) # adding plus 1 since the result needs to be in count from 1 format
    else:
        count = count + 1
    
print(' '.join(map(str,locations)))

print("\n---\n")

ls -l
-rw-rw-r-- 1 ubuntujuan ubuntujuan 502831487 mar  2 13:47 name.bin
ls -lh 
-rw-rw-r-- 1 ubuntujuan ubuntujuan 480M mar 16 21:49 xxx.bin
# Single line comments start with a number symbol.

""" Multiline strings can be written
    using three "s, and are often used
    as documentation.
"""

####################################################
## 1. Primitive Datatypes and Operators
####################################################

# You have numbers
3  # => 3

# Math is what you would expect
1 + 1   # => 2
8 - 1   # => 7
10 * 2  # => 20
35 / 5  # => 7.0

# Integer division rounds down for both positive and negative numbers.
5 // 3       # => 1
-5 // 3      # => -2
5.0 // 3.0   # => 1.0 # works on floats too
-5.0 // 3.0  # => -2.0

# The result of division is always a float
10.0 / 3  # => 3.3333333333333335

# Modulo operation
7 % 3   # => 1
# i % j have the same sign as j, unlike C
-7 % 3  # => 2

# Exponentiation (x**y, x to the yth power)
2**3  # => 8

# Enforce precedence with parentheses
1 + 3 * 2    # => 7
(1 + 3) * 2  # => 8

# Boolean values are primitives (Note: the capitalization)
True   # => True
False  # => False

# negate with not
not True   # => False
not False  # => True

# Boolean Operators
# Note "and" and "or" are case-sensitive
True and False  # => False
False or True   # => True

# True and False are actually 1 and 0 but with different keywords
True + True # => 2
True * 8    # => 8
False - 5   # => -5

# Comparison operators look at the numerical value of True and False
0 == False  # => True
2 > True    # => True
2 == True   # => False
-5 != False # => True

# None, 0, and empty strings/lists/dicts/tuples/sets all evaluate to False.
# All other values are True
bool(0)     # => False
bool("")    # => False
bool([])    # => False
bool({})    # => False
bool(())    # => False
bool(set()) # => False
bool(4)     # => True
bool(-6)    # => True

# Using boolean logical operators on ints casts them to booleans for evaluation,
# but their non-cast value is returned. Don't mix up with bool(ints) and bitwise
# and/or (&,|)
bool(0)     # => False
bool(2)     # => True
0 and 2     # => 0
bool(-5)    # => True
bool(2)     # => True
-5 or 0     # => -5

# Equality is ==
1 == 1  # => True
2 == 1  # => False

# Inequality is !=
1 != 1  # => False
2 != 1  # => True

# More comparisons
1 < 10  # => True
1 > 10  # => False
2 <= 2  # => True
2 >= 2  # => True

# Seeing whether a value is in a range
1 < 2 and 2 < 3  # => True
2 < 3 and 3 < 2  # => False
# Chaining makes this look nicer
1 < 2 < 3  # => True
2 < 3 < 2  # => False

# (is vs. ==) is checks if two variables refer to the same object, but == checks
# if the objects pointed to have the same values.
a = [1, 2, 3, 4]  # Point a at a new list, [1, 2, 3, 4]
b = a             # Point b at what a is pointing to
b is a            # => True, a and b refer to the same object
b == a            # => True, a's and b's objects are equal
b = [1, 2, 3, 4]  # Point b at a new list, [1, 2, 3, 4]
b is a            # => False, a and b do not refer to the same object
b == a            # => True, a's and b's objects are equal

# Strings are created with " or '
"This is a string."
'This is also a string.'

# Strings can be added too
"Hello " + "world!"  # => "Hello world!"
# String literals (but not variables) can be concatenated without using '+'
"Hello " "world!"    # => "Hello world!"

# A string can be treated like a list of characters
"Hello world!"[0]  # => 'H'

# You can find the length of a string
len("This is a string")  # => 16

# Since Python 3.6, you can use f-strings or formatted string literals.
name = "Reiko"
f"She said her name is {name}." # => "She said her name is Reiko"
# Any valid Python expression inside these braces is returned to the string.
f"{name} is {len(name)} characters long." # => "Reiko is 5 characters long."

# None is an object
None  # => None

# Don't use the equality "==" symbol to compare objects to None
# Use "is" instead. This checks for equality of object identity.
"etc" is None  # => False
None is None   # => True

####################################################
## 2. Variables and Collections
####################################################

# Python has a print function
print("I'm Python. Nice to meet you!")  # => I'm Python. Nice to meet you!

# By default the print function also prints out a newline at the end.
# Use the optional argument end to change the end string.
print("Hello, World", end="!")  # => Hello, World!

# Simple way to get input data from console
input_string_var = input("Enter some data: ") # Returns the data as a string

# There are no declarations, only assignments.
# Convention is to use lower_case_with_underscores
some_var = 5
some_var  # => 5

# Accessing a previously unassigned variable is an exception.
# See Control Flow to learn more about exception handling.
some_unknown_var  # Raises a NameError

# if can be used as an expression
# Equivalent of C's '?:' ternary operator
"yay!" if 0 > 1 else "nay!"  # => "nay!"

# Lists store sequences
li = []
# You can start with a prefilled list
other_li = [4, 5, 6]

# Add stuff to the end of a list with append
li.append(1)    # li is now [1]
li.append(2)    # li is now [1, 2]
li.append(4)    # li is now [1, 2, 4]
li.append(3)    # li is now [1, 2, 4, 3]
# Remove from the end with pop
li.pop()        # => 3 and li is now [1, 2, 4]
# Let's put it back
li.append(3)    # li is now [1, 2, 4, 3] again.

# Access a list like you would any array
li[0]   # => 1
# Look at the last element
li[-1]  # => 3

# Looking out of bounds is an IndexError
li[4]  # Raises an IndexError

# You can look at ranges with slice syntax.
# The start index is included, the end index is not
# (It's a closed/open range for you mathy types.)
li[1:3]   # Return list from index 1 to 3 => [2, 4]
li[2:]    # Return list starting from index 2 => [4, 3]
li[:3]    # Return list from beginning until index 3  => [1, 2, 4]
li[::2]   # Return list selecting every second entry => [1, 4]
li[::-1]  # Return list in reverse order => [3, 4, 2, 1]
# Use any combination of these to make advanced slices
# li[start:end:step]

# Make a one layer deep copy using slices
li2 = li[:]  # => li2 = [1, 2, 4, 3] but (li2 is li) will result in false.

# Remove arbitrary elements from a list with "del"
del li[2]  # li is now [1, 2, 3]

# Remove first occurrence of a value
li.remove(2)  # li is now [1, 3]
li.remove(2)  # Raises a ValueError as 2 is not in the list

# Insert an element at a specific index
li.insert(1, 2)  # li is now [1, 2, 3] again

# Get the index of the first item found matching the argument
li.index(2)  # => 1
li.index(4)  # Raises a ValueError as 4 is not in the list

# You can add lists
# Note: values for li and for other_li are not modified.
li + other_li  # => [1, 2, 3, 4, 5, 6]

# Concatenate lists with "extend()"
li.extend(other_li)  # Now li is [1, 2, 3, 4, 5, 6]

# Check for existence in a list with "in"
1 in li  # => True

# Examine the length with "len()"
len(li)  # => 6


# Tuples are like lists but are immutable.
tup = (1, 2, 3)
tup[0]      # => 1
tup[0] = 3  # Raises a TypeError

# Note that a tuple of length one has to have a comma after the last element but
# tuples of other lengths, even zero, do not.
type((1))   # => <class 'int'>
type((1,))  # => <class 'tuple'>
type(())    # => <class 'tuple'>

# You can do most of the list operations on tuples too
len(tup)         # => 3
tup + (4, 5, 6)  # => (1, 2, 3, 4, 5, 6)
tup[:2]          # => (1, 2)
2 in tup         # => True

# You can unpack tuples (or lists) into variables
a, b, c = (1, 2, 3)  # a is now 1, b is now 2 and c is now 3
# You can also do extended unpacking
a, *b, c = (1, 2, 3, 4)  # a is now 1, b is now [2, 3] and c is now 4
# Tuples are created by default if you leave out the parentheses
d, e, f = 4, 5, 6  # tuple 4, 5, 6 is unpacked into variables d, e and f
# respectively such that d = 4, e = 5 and f = 6
# Now look how easy it is to swap two values
e, d = d, e  # d is now 5 and e is now 4


# Dictionaries store mappings from keys to values
empty_dict = {}
# Here is a prefilled dictionary
filled_dict = {"one": 1, "two": 2, "three": 3}

# Note keys for dictionaries have to be immutable types. This is to ensure that
# the key can be converted to a constant hash value for quick look-ups.
# Immutable types include ints, floats, strings, tuples.
invalid_dict = {[1,2,3]: "123"}  # => Yield a TypeError: unhashable type: 'list'
valid_dict = {(1,2,3):[1,2,3]}   # Values can be of any type, however.

# Look up values with []
filled_dict["one"]  # => 1

# Get all keys as an iterable with "keys()". We need to wrap the call in list()
# to turn it into a list. We'll talk about those later.  Note - for Python
# versions <3.7, dictionary key ordering is not guaranteed. Your results might
# not match the example below exactly. However, as of Python 3.7, dictionary
# items maintain the order at which they are inserted into the dictionary.
list(filled_dict.keys())  # => ["three", "two", "one"] in Python <3.7
list(filled_dict.keys())  # => ["one", "two", "three"] in Python 3.7+


# Get all values as an iterable with "values()". Once again we need to wrap it
# in list() to get it out of the iterable. Note - Same as above regarding key
# ordering.
list(filled_dict.values())  # => [3, 2, 1]  in Python <3.7
list(filled_dict.values())  # => [1, 2, 3] in Python 3.7+

# Check for existence of keys in a dictionary with "in"
"one" in filled_dict  # => True
1 in filled_dict      # => False

# Looking up a non-existing key is a KeyError
filled_dict["four"]  # KeyError

# Use "get()" method to avoid the KeyError
filled_dict.get("one")      # => 1
filled_dict.get("four")     # => None
# The get method supports a default argument when the value is missing
filled_dict.get("one", 4)   # => 1
filled_dict.get("four", 4)  # => 4

# "setdefault()" inserts into a dictionary only if the given key isn't present
filled_dict.setdefault("five", 5)  # filled_dict["five"] is set to 5
filled_dict.setdefault("five", 6)  # filled_dict["five"] is still 5

# Adding to a dictionary
filled_dict.update({"four":4})  # => {"one": 1, "two": 2, "three": 3, "four": 4}
filled_dict["four"] = 4         # another way to add to dict

# Remove keys from a dictionary with del
del filled_dict["one"]  # Removes the key "one" from filled dict

# From Python 3.5 you can also use the additional unpacking options
{'a': 1, **{'b': 2}}  # => {'a': 1, 'b': 2}
{'a': 1, **{'a': 2}}  # => {'a': 2}



# Sets store ... well sets
empty_set = set()
# Initialize a set with a bunch of values.
some_set = {1, 1, 2, 2, 3, 4}  # some_set is now {1, 2, 3, 4}

# Similar to keys of a dictionary, elements of a set have to be immutable.
invalid_set = {[1], 1}  # => Raises a TypeError: unhashable type: 'list'
valid_set = {(1,), 1}

# Add one more item to the set
filled_set = some_set
filled_set.add(5)  # filled_set is now {1, 2, 3, 4, 5}
# Sets do not have duplicate elements
filled_set.add(5)  # it remains as before {1, 2, 3, 4, 5}

# Do set intersection with &
other_set = {3, 4, 5, 6}
filled_set & other_set  # => {3, 4, 5}

# Do set union with |
filled_set | other_set  # => {1, 2, 3, 4, 5, 6}

# Do set difference with -
{1, 2, 3, 4} - {2, 3, 5}  # => {1, 4}

# Do set symmetric difference with ^
{1, 2, 3, 4} ^ {2, 3, 5}  # => {1, 4, 5}

# Check if set on the left is a superset of set on the right
{1, 2} >= {1, 2, 3} # => False

# Check if set on the left is a subset of set on the right
{1, 2} <= {1, 2, 3} # => True

# Check for existence in a set with in
2 in filled_set   # => True
10 in filled_set  # => False

# Make a one layer deep copy
filled_set = some_set.copy()  # filled_set is {1, 2, 3, 4, 5}
filled_set is some_set        # => False


####################################################
## 3. Control Flow and Iterables
####################################################

# Let's just make a variable
some_var = 5

# Here is an if statement. Indentation is significant in Python!
# Convention is to use four spaces, not tabs.
# This prints "some_var is smaller than 10"
if some_var > 10:
    print("some_var is totally bigger than 10.")
elif some_var < 10:    # This elif clause is optional.
    print("some_var is smaller than 10.")
else:                  # This is optional too.
    print("some_var is indeed 10.")


"""
For loops iterate over lists
prints:
    dog is a mammal
    cat is a mammal
    mouse is a mammal
"""
for animal in ["dog", "cat", "mouse"]:
    # You can use format() to interpolate formatted strings
    print("{} is a mammal".format(animal))

"""
"range(number)" returns an iterable of numbers
from zero up to (but excluding) the given number
prints:
    0
    1
    2
    3
"""
for i in range(4):
    print(i)

"""
"range(lower, upper)" returns an iterable of numbers
from the lower number to the upper number
prints:
    4
    5
    6
    7
"""
for i in range(4, 8):
    print(i)

"""
"range(lower, upper, step)" returns an iterable of numbers
from the lower number to the upper number, while incrementing
by step. If step is not indicated, the default value is 1.
prints:
    4
    6
"""
for i in range(4, 8, 2):
    print(i)

"""
Loop over a list to retrieve both the index and the value of each list item:
    0 dog
    1 cat
    2 mouse
"""
animals = ["dog", "cat", "mouse"]
for i, value in enumerate(animals):
    print(i, value)

"""
While loops go until a condition is no longer met.
prints:
    0
    1
    2
    3
"""
x = 0
while x < 4:
    print(x)
    x += 1  # Shorthand for x = x + 1

# Handle exceptions with a try/except block
try:
    # Use "raise" to raise an error
    raise IndexError("This is an index error")
except IndexError as e:
    pass                 # Refrain from this, provide a recovery (next example).
except (TypeError, NameError):
    pass                 # Multiple exceptions can be processed jointly.
else:                    # Optional clause to the try/except block. Must follow
                         # all except blocks.
    print("All good!")   # Runs only if the code in try raises no exceptions
finally:                 # Execute under all circumstances
    print("We can clean up resources here")

# Instead of try/finally to cleanup resources you can use a with statement
with open("myfile.txt") as f:
    for line in f:
        print(line)

# Writing to a file
contents = {"aa": 12, "bb": 21}
with open("myfile1.txt", "w+") as file:
    file.write(str(contents))        # writes a string to a file

import json
with open("myfile2.txt", "w+") as file:
    file.write(json.dumps(contents)) # writes an object to a file

# Reading from a file
with open('myfile1.txt', "r+") as file:
    contents = file.read()           # reads a string from a file
print(contents)
# print: {"aa": 12, "bb": 21}

with open('myfile2.txt', "r+") as file:
    contents = json.load(file)       # reads a json object from a file
print(contents)
# print: {"aa": 12, "bb": 21}


# Python offers a fundamental abstraction called the Iterable.
# An iterable is an object that can be treated as a sequence.
# The object returned by the range function, is an iterable.

filled_dict = {"one": 1, "two": 2, "three": 3}
our_iterable = filled_dict.keys()
print(our_iterable)  # => dict_keys(['one', 'two', 'three']). This is an object
                     # that implements our Iterable interface.

# We can loop over it.
for i in our_iterable:
    print(i)  # Prints one, two, three

# However we cannot address elements by index.
our_iterable[1]  # Raises a TypeError

# An iterable is an object that knows how to create an iterator.
our_iterator = iter(our_iterable)

# Our iterator is an object that can remember the state as we traverse through
# it. We get the next object with "next()".
next(our_iterator)  # => "one"

# It maintains state as we iterate.
next(our_iterator)  # => "two"
next(our_iterator)  # => "three"

# After the iterator has returned all of its data, it raises a
# StopIteration exception
next(our_iterator)  # Raises StopIteration

# We can also loop over it, in fact, "for" does this implicitly!
our_iterator = iter(our_iterable)
for i in our_iterator:
    print(i)  # Prints one, two, three

# You can grab all the elements of an iterable or iterator by call of list().
list(our_iterable)  # => Returns ["one", "two", "three"]
list(our_iterator)  # => Returns [] because state is saved


####################################################
## 4. Functions
####################################################

# Use "def" to create new functions
def add(x, y):
    print("x is {} and y is {}".format(x, y))
    return x + y  # Return values with a return statement

# Calling functions with parameters
add(5, 6)  # => prints out "x is 5 and y is 6" and returns 11

# Another way to call functions is with keyword arguments
add(y=6, x=5)  # Keyword arguments can arrive in any order.

# You can define functions that take a variable number of
# positional arguments
def varargs(*args):
    return args

varargs(1, 2, 3)  # => (1, 2, 3)

# You can define functions that take a variable number of
# keyword arguments, as well
def keyword_args(**kwargs):
    return kwargs

# Let's call it to see what happens
keyword_args(big="foot", loch="ness")  # => {"big": "foot", "loch": "ness"}


# You can do both at once, if you like
def all_the_args(*args, **kwargs):
    print(args)
    print(kwargs)
"""
all_the_args(1, 2, a=3, b=4) prints:
    (1, 2)
    {"a": 3, "b": 4}
"""

# When calling functions, you can do the opposite of args/kwargs!
# Use * to expand tuples and use ** to expand kwargs.
args = (1, 2, 3, 4)
kwargs = {"a": 3, "b": 4}
all_the_args(*args)            # equivalent: all_the_args(1, 2, 3, 4)
all_the_args(**kwargs)         # equivalent: all_the_args(a=3, b=4)
all_the_args(*args, **kwargs)  # equivalent: all_the_args(1, 2, 3, 4, a=3, b=4)

# Returning multiple values (with tuple assignments)
def swap(x, y):
    return y, x  # Return multiple values as a tuple without the parenthesis.
                 # (Note: parenthesis have been excluded but can be included)

x = 1
y = 2
x, y = swap(x, y)     # => x = 2, y = 1
# (x, y) = swap(x,y)  # Again the use of parenthesis is optional.

# global scope
x = 5

def set_x(num):
    # local scope begins here
    # local var x not the same as global var x
    x = num    # => 43
    print(x)   # => 43

def set_global_x(num):
    # global indicates that particular var lives in the global scope
    global x
    print(x)   # => 5
    x = num    # global var x is now set to 6
    print(x)   # => 6

set_x(43)
set_global_x(6)
"""
prints:
    43
    5
    6
"""


# Python has first class functions
def create_adder(x):
    def adder(y):
        return x + y
    return adder

add_10 = create_adder(10)
add_10(3)   # => 13

# There are also anonymous functions
(lambda x: x > 2)(3)                  # => True
(lambda x, y: x ** 2 + y ** 2)(2, 1)  # => 5

# There are built-in higher order functions
list(map(add_10, [1, 2, 3]))          # => [11, 12, 13]
list(map(max, [1, 2, 3], [4, 2, 1]))  # => [4, 2, 3]

list(filter(lambda x: x > 5, [3, 4, 5, 6, 7]))  # => [6, 7]

# We can use list comprehensions for nice maps and filters
# List comprehension stores the output as a list (which itself may be nested).
[add_10(i) for i in [1, 2, 3]]         # => [11, 12, 13]
[x for x in [3, 4, 5, 6, 7] if x > 5]  # => [6, 7]

# You can construct set and dict comprehensions as well.
{x for x in 'abcddeef' if x not in 'abc'}  # => {'d', 'e', 'f'}
{x: x**2 for x in range(5)}  # => {0: 0, 1: 1, 2: 4, 3: 9, 4: 16}


####################################################
## 5. Modules
####################################################

# You can import modules
import math
print(math.sqrt(16))  # => 4.0

# You can get specific functions from a module
from math import ceil, floor
print(ceil(3.7))   # => 4.0
print(floor(3.7))  # => 3.0

# You can import all functions from a module.
# Warning: this is not recommended
from math import *

# You can shorten module names
import math as m
math.sqrt(16) == m.sqrt(16)  # => True

# Python modules are just ordinary Python files. You
# can write your own, and import them. The name of the
# module is the same as the name of the file.

# You can find out which functions and attributes
# are defined in a module.
import math
dir(math)

# If you have a Python script named math.py in the same
# folder as your current script, the file math.py will
# be loaded instead of the built-in Python module.
# This happens because the local folder has priority
# over Python's built-in libraries.


####################################################
## 6. Classes
####################################################

# We use the "class" statement to create a class
class Human:

    # A class attribute. It is shared by all instances of this class
    species = "H. sapiens"

    # Basic initializer, this is called when this class is instantiated.
    # Note that the double leading and trailing underscores denote objects
    # or attributes that are used by Python but that live in user-controlled
    # namespaces. Methods(or objects or attributes) like: __init__, __str__,
    # __repr__ etc. are called special methods (or sometimes called dunder
    # methods). You should not invent such names on your own.
    def __init__(self, name):
        # Assign the argument to the instance's name attribute
        self.name = name

        # Initialize property
        self._age = 0

    # An instance method. All methods take "self" as the first argument
    def say(self, msg):
        print("{name}: {message}".format(name=self.name, message=msg))

    # Another instance method
    def sing(self):
        return 'yo... yo... microphone check... one two... one two...'

    # A class method is shared among all instances
    # They are called with the calling class as the first argument
    @classmethod
    def get_species(cls):
        return cls.species

    # A static method is called without a class or instance reference
    @staticmethod
    def grunt():
        return "*grunt*"

    # A property is just like a getter.
    # It turns the method age() into a read-only attribute of the same name.
    # There's no need to write trivial getters and setters in Python, though.
    @property
    def age(self):
        return self._age

    # This allows the property to be set
    @age.setter
    def age(self, age):
        self._age = age

    # This allows the property to be deleted
    @age.deleter
    def age(self):
        del self._age


# When a Python interpreter reads a source file it executes all its code.
# This __name__ check makes sure this code block is only executed when this
# module is the main program.
if __name__ == '__main__':
    # Instantiate a class
    i = Human(name="Ian")
    i.say("hi")                     # "Ian: hi"
    j = Human("Joel")
    j.say("hello")                  # "Joel: hello"
    # i and j are instances of type Human; i.e., they are Human objects.

    # Call our class method
    i.say(i.get_species())          # "Ian: H. sapiens"
    # Change the shared attribute
    Human.species = "H. neanderthalensis"
    i.say(i.get_species())          # => "Ian: H. neanderthalensis"
    j.say(j.get_species())          # => "Joel: H. neanderthalensis"

    # Call the static method
    print(Human.grunt())            # => "*grunt*"

    # Static methods can be called by instances too
    print(i.grunt())                # => "*grunt*"

    # Update the property for this instance
    i.age = 42
    # Get the property
    i.say(i.age)                    # => "Ian: 42"
    j.say(j.age)                    # => "Joel: 0"
    # Delete the property
    del i.age
    # i.age                         # => this would raise an AttributeError


####################################################
## 6.1 Inheritance
####################################################

# Inheritance allows new child classes to be defined that inherit methods and
# variables from their parent class.

# Using the Human class defined above as the base or parent class, we can
# define a child class, Superhero, which inherits the class variables like
# "species", "name", and "age", as well as methods, like "sing" and "grunt"
# from the Human class, but can also have its own unique properties.

# To take advantage of modularization by file you could place the classes above
# in their own files, say, human.py

# To import functions from other files use the following format
# from "filename-without-extension" import "function-or-class"

from human import Human


# Specify the parent class(es) as parameters to the class definition
class Superhero(Human):

    # If the child class should inherit all of the parent's definitions without
    # any modifications, you can just use the "pass" keyword (and nothing else)
    # but in this case it is commented out to allow for a unique child class:
    # pass

    # Child classes can override their parents' attributes
    species = 'Superhuman'

    # Children automatically inherit their parent class's constructor including
    # its arguments, but can also define additional arguments or definitions
    # and override its methods such as the class constructor.
    # This constructor inherits the "name" argument from the "Human" class and
    # adds the "superpower" and "movie" arguments:
    def __init__(self, name, movie=False,
                 superpowers=["super strength", "bulletproofing"]):

        # add additional class attributes:
        self.fictional = True
        self.movie = movie
        # be aware of mutable default values, since defaults are shared
        self.superpowers = superpowers

        # The "super" function lets you access the parent class's methods
        # that are overridden by the child, in this case, the __init__ method.
        # This calls the parent class constructor:
        super().__init__(name)

    # override the sing method
    def sing(self):
        return 'Dun, dun, DUN!'

    # add an additional instance method
    def boast(self):
        for power in self.superpowers:
            print("I wield the power of {pow}!".format(pow=power))


if __name__ == '__main__':
    sup = Superhero(name="Tick")

    # Instance type checks
    if isinstance(sup, Human):
        print('I am human')
    if type(sup) is Superhero:
        print('I am a superhero')

    # Get the Method Resolution search Order used by both getattr() and super()
    # This attribute is dynamic and can be updated
    print(Superhero.__mro__)    # => (<class '__main__.Superhero'>,
                                # => <class 'human.Human'>, <class 'object'>)

    # Calls parent method but uses its own class attribute
    print(sup.get_species())    # => Superhuman

    # Calls overridden method
    print(sup.sing())           # => Dun, dun, DUN!

    # Calls method from Human
    sup.say('Spoon')            # => Tick: Spoon

    # Call method that exists only in Superhero
    sup.boast()                 # => I wield the power of super strength!
                                # => I wield the power of bulletproofing!

    # Inherited class attribute
    sup.age = 31
    print(sup.age)              # => 31

    # Attribute that only exists within Superhero
    print('Am I Oscar eligible? ' + str(sup.movie))

####################################################
## 6.2 Multiple Inheritance
####################################################

# Another class definition
# bat.py
class Bat:

    species = 'Baty'

    def __init__(self, can_fly=True):
        self.fly = can_fly

    # This class also has a say method
    def say(self, msg):
        msg = '... ... ...'
        return msg

    # And its own method as well
    def sonar(self):
        return '))) ... ((('

if __name__ == '__main__':
    b = Bat()
    print(b.say('hello'))
    print(b.fly)


# And yet another class definition that inherits from Superhero and Bat
# superhero.py
from superhero import Superhero
from bat import Bat

# Define Batman as a child that inherits from both Superhero and Bat
class Batman(Superhero, Bat):

    def __init__(self, *args, **kwargs):
        # Typically to inherit attributes you have to call super:
        # super(Batman, self).__init__(*args, **kwargs)
        # However we are dealing with multiple inheritance here, and super()
        # only works with the next base class in the MRO list.
        # So instead we explicitly call __init__ for all ancestors.
        # The use of *args and **kwargs allows for a clean way to pass
        # arguments, with each parent "peeling a layer of the onion".
        Superhero.__init__(self, 'anonymous', movie=True,
                           superpowers=['Wealthy'], *args, **kwargs)
        Bat.__init__(self, *args, can_fly=False, **kwargs)
        # override the value for the name attribute
        self.name = 'Sad Affleck'

    def sing(self):
        return 'nan nan nan nan nan batman!'


if __name__ == '__main__':
    sup = Batman()

    # Get the Method Resolution search Order used by both getattr() and super().
    # This attribute is dynamic and can be updated
    print(Batman.__mro__)       # => (<class '__main__.Batman'>,
                                # => <class 'superhero.Superhero'>,
                                # => <class 'human.Human'>,
                                # => <class 'bat.Bat'>, <class 'object'>)

    # Calls parent method but uses its own class attribute
    print(sup.get_species())    # => Superhuman

    # Calls overridden method
    print(sup.sing())           # => nan nan nan nan nan batman!

    # Calls method from Human, because inheritance order matters
    sup.say('I agree')          # => Sad Affleck: I agree

    # Call method that exists only in 2nd ancestor
    print(sup.sonar())          # => ))) ... (((

    # Inherited class attribute
    sup.age = 100
    print(sup.age)              # => 100

    # Inherited attribute from 2nd ancestor whose default value was overridden.
    print('Can I fly? ' + str(sup.fly)) # => Can I fly? False



####################################################
## 7. Advanced
####################################################

# Generators help you make lazy code.
def double_numbers(iterable):
    for i in iterable:
        yield i + i

# Generators are memory-efficient because they only load the data needed to
# process the next value in the iterable. This allows them to perform
# operations on otherwise prohibitively large value ranges.
# NOTE: `range` replaces `xrange` in Python 3.
for i in double_numbers(range(1, 900000000)):  # `range` is a generator.
    print(i)
    if i >= 30:
        break

# Just as you can create a list comprehension, you can create generator
# comprehensions as well.
values = (-x for x in [1,2,3,4,5])
for x in values:
    print(x)  # prints -1 -2 -3 -4 -5 to console/terminal

# You can also cast a generator comprehension directly to a list.
values = (-x for x in [1,2,3,4,5])
gen_to_list = list(values)
print(gen_to_list)  # => [-1, -2, -3, -4, -5]


# Decorators
# In this example `beg` wraps `say`. If say_please is True then it
# will change the returned message.
from functools import wraps


def beg(target_function):
    @wraps(target_function)
    def wrapper(*args, **kwargs):
        msg, say_please = target_function(*args, **kwargs)
        if say_please:
            return "{} {}".format(msg, "Please! I am poor :(")
        return msg

    return wrapper


@beg
def say(say_please=False):
    msg = "Can you buy me a beer?"
    return msg, say_please


print(say())                 # Can you buy me a beer?
print(say(say_please=True))  # Can you buy me a beer? Please! I am poor :(
/* Use */ 
visibility: hidden 
/* when you want to hide an element from view but still want it to occupy space on the page. This can be useful when you want to reveal the element later or when you want to maintain the layout of the page. */

/* Use */
display: none 
/* when you want to completely remove an element from the page and don’t want it to occupy any space. This can be useful when you want to completely hide an element and don’t plan to reveal it later. */
add_action('check_admin_referer', 'logout_without_confirm', 10, 2);
function logout_without_confirm($action, $result)
{
    /**
     * Allow logout without confirmation
     */
    if ($action == "log-out" && !isset($_GET['_wpnonce'])) {
        $redirect_to = isset($_REQUEST['redirect_to']) ? $_REQUEST['redirect_to'] : 'https://yourdomain.com';
        $location = str_replace('&amp;', '&', wp_logout_url($redirect_to));
        header("Location: $location");
        die;
    }
}
import win32api

drives = win32api.GetLogicalDriveStrings()
drives = drives.split('\000')[:-1]
print drives
For this, we would advise the client or the client’s web development team handle the integration using our convenient help documentation. Web apps are something that requires intimate knowledge of the structure and composition of the site. So, it’s best left to the creator or maintainer of said app to integrate new technologies onto it.

Here is the web integration best practices doc which links to things like adding links and information about the style sheet and API.

And Here is a link to the FareHarbor button generator where the client can experiment with the different styles of buttons and get an html output for the ones they like.

All of these are client-facing.
Help Plant The Seeds To Success!
Success not only of this Business, but also the success of those who are moved by this business! Your support and contributions will enable me to meet my goals and improve the site and the availability of items on the site. Your generous donation will fund my mission to empower  everyone who takes the time aside to allow themselves to receive this epic, life-changing compilation of anything that aligns with the practices and goals outlined in my "guides (if you will)".

Thank you to any whom can and do donate! You are helping a young woman achieve her dreams of becoming her own boss!T
About This Page
What Life Do You Desire?
What is it that you want to see change in your life or maybe even the lives of others?

What We Offer
What is offered here is the chance to pen your mind to the idea that you have more control over the experience we call life than you may even realize, and maybe more than you even want.

How Could That Be?
You could be inadvertently controlling the factors in life to be a negative experience for yourself or others, without lifting a finger, sometimes instantaneously.






























Help Plant The Seeds To Success!
Success not only of this Business, but also the success of those who are moved by this business! Your support and contributions will enable me to meet my goals and improve the site and the availability of items on the site. Your generous donation will fund my mission to empower  everyone who takes the time aside to allow themselves to receive this epic, life-changing compilation of anything that aligns with the practices and goals outlined in my "guides (if you will)".

Thank you to any whom can and do donate! You are helping a young woman achieve her dreams of becoming her own boss!


























































































DONATE

Stay In The Know!
Sign up to get notified about any additions to my pages!

Email
SUBMIT
Questions, Comments, Concerns? Get In Touch Now!
If you seek to communicate with me directly in regards to any (business related) topic, kindly provide...
Your Name (First, Last)*
Phone Number*
Email*

Permission To Communicate Via Text Messaging (SMS)?*
Files (optional)
Attachments (0)
PRESS THIS SEND BUTTON IF YOUR FINISHED!
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.

Response times may vary due to personal schedule, please be patient. I will get to every inquiry.
I will constantly check my inbox and make sure that no one whom requires response is left unanswered.
Please be respectful and know that this is in no way a secured line of communication. I can not guarantee the safety of any information through communication of any kind. As such, please be aware to not give out any information like SSN, passwords or other information that could lead to theft of identity or any other negatively effecting event.

Bringing Prosperity To Life
Peoria, Arizona 85345, United States

Get In Touch above is a better way of ensuring that all the necessary information needed to address your concern is met. If, for any reason, you desire I may be reached @
Phone Number : (775)46-VENUS (775)468-3687
E-mail : prosperitytolife@gmail.com

Donations Are Welcomed Always!
   I you are feeling generous, I could always use some money.

I have been and recently conquered homelessness, however I have only barely begun my path to build a stable environment. I am working a part-time job, developing this business, and helping develop another as well, on top of trying to keep up with household du

HELP VENUS & THIS BUSINESS THRIVE
Powered by

Copyright © 2023 Bringing Prosperity To Life - All Rights Reserved.

Home
Privacy
class Solution {
  public:
    // Function to return the adjacency list for each vertex.
    vector<vector<int>> printGraph(int V, vector<int> adj[]) {
        vector<vector<int>> v2;
        for(int i=0;i<V;i++)
        {
            vector<int> v1;
            v1.push_back(i);
            for(int j=0;j<adj[i].size();j++)
            {
                v1.push_back(adj[i][j]);
            }
            v2.push_back(v1);
        }
        return v2;
    }
};
# import all the required libraries
import numpy as np
import pandas as pd
# import matplotlib.pyplot as plt
# from sklearn.preprocessing import MinMaxScaler
# import scipy as sp

# read data from the data set
ds1 = pd.read_csv("dataset.csv")

# ds2 = pd.read_json("json_filename")
# ds3 = pd.read_text("text_filename")
# ds4 = pd.read_excel("xlsx_filename")
# ds5 = pd.read_html("html_filename")
# ds6 = pd.read_xml("xml_filename")


# PERFORM OPERATIONS ON THE DATA FRAME

# print(ds1.head())

# print(ds1.tail())


# print("Shape:", ds1.shape)

# print("Columns:", ds1.columns)

# print("Describe:", ds1.describe())


# print(ds1.info())

# print("Size:", ds1.size)


# print("isna: \n",ds1.isna().sum())


# isna().sum()



# print("isnull: \n",ds1.isnull().sum())

#print(ds1.info())

# isnull:      gender  NationalITy  ...  StudentAbsenceDays  Class
# 0     False        False  ...               False  False
# 1     False        False  ...               False  False
# 2     False        False  ...               False  False
# 3     False        False  ...               False  False
# 4     False        False  ...               False  False
# ..      ...          ...  ...                 ...    ...
# 475   False        False  ...               False  False
# 476   False        False  ...               False  False
# 477   False        False  ...               False  False
# 478   False        False  ...               False  False
# 479   False        False  ...               False  False

ds1['raisehands']= ds1['raisedhands'].astype('int64')
#print(ds1.dtypes)
#print(ds1.dtypes)
#print(ds1.dtypes['ssc_p'])

#di = {'Roll':[1,2,3,4,5],
#'Name':['a','b','c','d','e']}

#ds1 = pd.DataFrame(di)
#print(ds1)

#output 

#ds1['Roll'].replace([1], [], inplace = True)
#print(ds1)


#print(ds1.interpolate().count())

#print(ds1.interpolate())

ds1{'raisedhands'} =ds1
//Code to show current categorised recent viewed featured most viewed products
add_filter( 'sp_wpspro_arg', 'wpspro_current_categorised_recent_viewed_featured_most_viewed_products', 10, 2 );
function wpspro_current_categorised_recent_viewed_featured_most_viewed_products($arg, $shortcode_id) {
	if('187' == $shortcode_id || '189' == $shortcode_id || '190' == $shortcode_id ) {
		
		$wpspro_current_category_obj = get_queried_object();
		if ( isset( $wpspro_current_category_obj->term_id ) ) {
			
			$arg['tax_query'][] = array(
				'taxonomy' => 'product_cat',
				'field'    => 'term_id',
				'terms'    => $wpspro_current_category_obj->term_id,
				'operator' => 'IN',
			);
		}
	} 
	return $arg;
}
df1 = df1[df1['Target_ID'].str.contains("HUMAN")] 
<script runat="server">
    Platform.Load("Core","1.1.1");
    try{
  </script>
%%[
/* get subKey from the email this came from */
  SET @contactId = RequestParameter("subKey")
  
  IF NOT EMPTY(@contactId) THEN

  SET @subscriberRows = RetrieveSalesforceObjects(
   "Lead", 
   "Id, Xa__c, Xb__c, Xc__c, Email, Phone, HasOptedOutOfEmail", 
   "Id", "=", @contactId
   )

  IF RowCount(@subscriberRows) == 1 THEN

  SET @row = row(@subscriberRows,1)
  SET @Xa = field(@row,"Xa__c")
  SET @Xb= field(@row,"Xb__c ")
  SET @Xc = field(@row,"Xc__c ")  

  SET @Email = field(@row,"Email")
  SET @Phone = field(@row, "Phone")

  SET @HasOptedOutOfEmail = field(@row,"HasOptedOutOfEmail")
  
  IF @Xa== false THEN SET @Xa_chk = "checked" ENDIF
  IF @Xb == false THEN SET @Xb_chk = "checked" ENDIF
  IF @Xc == false THEN SET @Xc_chk = "checked" ENDIF

ELSE
]%%
Sorry, something went wrong (no records found).
%%[
ENDIF
ELSE
]%%
Sorry, something went wrong (missing subscriber key). 
%%[
ENDIF
/* run this IF when page submitted */
IF RequestParameter("submitted") == true then

/* unsubscribed, so unsub from all preferences */
 IF RequestParameter("Unsubscribe from all") == "usub" THEN 
 /* update contact in Sales Cloud */
  SET @updateRecord = UpdateSingleSalesforceObject(
      "Lead", @contactId,
      "Xa__c", "true",
      "Xb__c", "true",
      "Xc__c", "true",
     
      "HasOptedOutOfEmail", "true"
     )  

 /* log unsubscribe event to mark as unsubscribed in All Subscribers */
 SET @reason = "Unsubscribed through custom subscription center"

SET @lue = CreateObject("ExecuteRequest")
SETObjectProperty(@lue,"Name","LogUnsubEvent")

SET @lue_prop = CreateObject("APIProperty")
SETObjectProperty(@lue_prop, "Name", "SubscriberKey")
SETObjectProperty(@lue_prop, "Value", @contactId)
AddObjectArrayItem(@lue, "Parameters", @lue_prop)

SET @lue_prop = CreateObject("APIProperty")
SETObjectProperty(@lue_prop, "Name", "Reason")
SETObjectProperty(@lue_prop, "Value", @reason)
AddObjectArrayItem(@lue, "Parameters", @lue_prop)

SET @lue_statusCode = InvokeExecute(@lue, @overallStatus, @requestId)

/* submitted, but didn't unsub from all, so update the preference variables */
elseif EMPTY(RequestParameter("Unsubscribe from all")) AND EMPTY(RequestParameter("sub")) THEN

/* update contact */
SET @updateRecord = UpdateSingleSalesforceObject(
      "Lead", @contactId,
      "Xa__c", Iif(EMPTY(RequestParameter("Xa")), "true", "false"),
      "Xb__c", Iif(EMPTY(RequestParameter("Xb")), "true", "false"),
      "Xc__c", Iif(EMPTY(RequestParameter("Xc")), "true", "false")
     )

/* form submit AND resubscribing */
ELSEIF RequestParameter("submitted") == true AND RequestParameter("sub") == true THEN

/* update contact in Sales Cloud */ 
 SET @contactId = RequestParameter("SubKey")

SET @updateRecord = UpdateSingleSalesforceObject(
    "Lead", @contactId,
    "Xa__c", "false",
    "Xb__c", "false",
    "Xc__c", "false",
    
    "HasOptedOutOfEmail", "false"
   )

  /* set subscriber status to active in All Subscribers */  
   
  SET @Subscriber = CreateObject("Subscriber")
   SetObjectProperty(@Subscriber, "SubscriberKey", @contactId)
  
   SetObjectProperty(@Subscriber, "Status", "Active" )
   SET @Status = InvokeUpdate(@Subscriber, @createErrDesc, @createErrNo, @createOpts)

   /* fetch updated data to show in the form */
   SET @subscriberRows = RetrieveSalesforceObjects(
"Lead",
   "Id, Email, Phone, Xa__c, Xb__c, Xc__c, HasOptedOutOfEmail",
   "Id", "=", @contactId
   )

  SET @row = row(@subscriberRows,1)
  SET @Xa = field(@row,"Xa__c")
  SET @Xb= field(@row,"Xb__c ")
  SET @Xc = field(@row,"Xc__c ")  

  SET @Email = field(@row,"Email")
  SET @Phone = field(@row, "Phone")

  SET @HasOptedOutOfEmail = field(@row,"HasOptedOutOfEmail")
  
  IF @Xa== false THEN SET @Xa_chk = "checked" ENDIF
  IF @Xb == false THEN SET @Xb_chk = "checked" ENDIF
  IF @Xc == false THEN SET @Xc_chk = "checked" ENDIF
 
ENDIF
ENDIF
]%%
<style>
  @media only screen and (max-width:600px)
  {
  .res
   {
    width:100% !important;
    display:inline-block; 
   }
  }
  .container
  {
   width:600px;
  }
  .border
  {
   border-style: solid;
  }
  .button 
  {
  
   border: none;
   color: White;
    background-color: #1b3d6d;
   padding:12px;
   text-align: center;
   text-decoration: none;
   display: inline-block;
   font-size: 14px;
   margin: 4px 2px;
   cursor: pointer;
   border-radius:25px;
  }
  .button1 {width: 160px;}
  </style>
      
      
      %%[IF @HasOptedOutOfEmail == true THEN]%%  
<h2 style="">
  <span style="font-family:'Roboto', sans-serif;"><span style="color:#1b3d6d;">Resubscribe</span></span></h2>
Let's reconnect! Click Resubscribe below to choose your personalized communications.&nbsp;

     <form action="%%=RequestParameter('PAGEURL')=%%" method="post">
              <center>
     <input name="submitted" type="hidden" value="true"><br> 
     <input name="resub" type="hidden" value="true">
     <input name="sub" type="hidden" value="true"><br>
     <input name="subKey" type="hidden" value="%%=v(@contactID)=%%"><br>
     <input class="button button1" type="submit" value="Resubscribe">
                </center>
        </form>

%%[ELSEIF RequestParameter("submitted") == true AND RequestParameter("resub") == false AND NOT EMPTY(@contactId) THEN]%%
<h2 style="">
  <span style="font-family:'Roboto', sans-serif;"><span style="color:#1b3d6d;">Thank you.</span></span></h2>
We will update your preferences at this time. Have a great day.&nbsp;

%%[ELSEIF (RequestParameter("submitted") == false OR RequestParameter("resub") == true) AND NOT EMPTY(@contactId) AND RowCount(@subscriberRows) > 0 THEN]%%


<span style="font-family:'Roboto', sans-serif;">Thank you for signing up to receive communications from Community Healthcare System. Please select or update your preferences below.&nbsp;</span><h2 style="">
 <span style="font-family:'Roboto', sans-serif;"><span style="color:#1b3d6d;">Personal Information</span></span></h2><span style="font-family:'Roboto', sans-serif;">Email Address: %%=v(@Email)=%%<br>
Mobile Phone: %%=v(@Phone)=%%</span><br>
<br>
&nbsp;<hr class="solid">

  
  <form action="%%=RequestParameter('PAGEURL')=%%" method="post">
    <div style="font-family:'Roboto', sans-serif">
     
      
<h2 style="">
 <span style="font-family:'Roboto', sans-serif;"><span style="color:#1b3d6d;">Preferences</span></span></h2><span style="font-family:'Roboto', sans-serif;">Select the information you would like to receive:<br>

      <br>
       <input %%=v(@Xa_chk)=%% name="Xa" type="checkbox" id="Xa" value="Xa">
       <label>Xa </label><br>
       <input %%=v(@Xb_chk)=%% name="Xb" type="checkbox" id="Xb" value="Xb">
       <label>Xb</label><br>
       <input %%=v(@Xc_chk)=%% name="Xc" type="checkbox" id="Xc" value="Xc">
       <label> Xc</label><br><br>
       
      
      </span>   
    </div>
  <br>
&nbsp;<hr class="solid">
                <script>

function uusub(){
  
    if(document.getElementById("usub").checked == true)
       {
           document.getElementById("Xa").checked = false;
           document.getElementById("Xb").checked = false;
           document.getElementById("Xc").checked = false;
       }
}
</script>
   
    
     
      
     <h2 style="">
 <span style="font-family:'Roboto', sans-serif;"><span style="color:#1b3d6d;">Unsubscribe</span></span></h2><span style="font-family:'Roboto', sans-serif;">If you prefer to stop receiving all communications from Community Healthcare System please select the below preference. You can always count on receiving messages related to account security, changes to appointments, and secured messages related to your medical care.&nbsp;<br>
<br>
      
     
   
    <div style="padding-bottom:40px;padding-top:20px;">
     
      
       
       <input name="Unsubscribe from all" type="checkbox" value="usub" id="usub" onchange="uusub()">
       <label>Stop all email communications  </label>
       
      
     
    </div>
     <div align="center" style="padding-bottom:20px;">
      
                        <input name="submitted" type="hidden" value="true"><br>
                        <input type="submit" value="Submit" class="button button1">
      
                    
     </div>
   </span>
                </form>

%%[ENDIF]%%
    <div style="padding-top:40px;color:#4d4dff;padding-bottom:20px;font-family:'Roboto', sans-serif;text-decoration:none;" align="center">
     
      <a href="#">Terms of Use</a> 
      |
      <a href="#">HIPPA</a> 
      |
      <a href="#">Privacy Practices</a>
     
    </div>
<!-- end of script -->
    <script runat="server">
  }catch(e){
    Write("Sorry, something went wrong: " + Stringify(e.message));
  }
</script>     
#include <iostream>
#include <string>
#include <cmath>

using namespace std;

int main()
{
    int w; // width of the building.
    int h; // height of the building.
    cin >> w >> h; cin.ignore();
    int n; // maximum number of turns before game over.
    cin >> n; cin.ignore();
    int x0;
    int y0;
    cin >> x0 >> y0; cin.ignore();
    int w0 = 0 , h0 = 0;

    // game loop
    while (1) {
        string bomb_dir; // the direction of the bombs from batman's current location (U, UR, R, DR, D, DL, L or UL)
        cin >> bomb_dir; cin.ignore();


        if (bomb_dir.find("U") != string::npos){
            h = y0;
            y0 = ((y0+h0)/2) ;
        }
        if (bomb_dir.find("D") != string::npos){
            h0 = y0;
            y0 = floor((y0+h)/2);
        }
        if(bomb_dir.find("R") != string::npos){
            w0 = x0;
            x0 = floor((x0+w) /2);
        }
        if(bomb_dir.find("L") != string::npos){
            w = x0;
            x0 = floor((x0+w0)/2);
        }

        cout << to_string(x0) + " " + to_string(y0) << endl;
    }
}
add_action( 'init', 'wpse26388_rewrites_init' );
function wpse26388_rewrites_init(){
    add_rewrite_rule(
        'properties/([0-9]+)/?$',
        'index.php?pagename=properties&property_id=$matches[1]',
        'top' );
}

add_filter( 'query_vars', 'wpse26388_query_vars' );
function wpse26388_query_vars( $query_vars ){
    $query_vars[] = 'property_id';
    return $query_vars;
}
sudo apt-get update && \
  sudo apt-get install -y aspnetcore-runtime-7.0
sudo apt-get install -y gpg
wget -O - https://packages.microsoft.com/keys/microsoft.asc | gpg --dearmor -o microsoft.asc.gpg
sudo mv microsoft.asc.gpg /etc/apt/trusted.gpg.d/
wget https://packages.microsoft.com/config/debian/{os-version}/prod.list
sudo mv prod.list /etc/apt/sources.list.d/microsoft-prod.list
sudo chown root:root /etc/apt/trusted.gpg.d/microsoft.asc.gpg
sudo chown root:root /etc/apt/sources.list.d/microsoft-prod.list
sudo apt-get update && \
  sudo apt-get install -y {dotnet-package}
sudo apt-get update && \
  sudo apt-get install -y dotnet-sdk-7.0
wget https://packages.microsoft.com/config/debian/11/packages-microsoft-prod.deb -O packages-microsoft-prod.deb
sudo dpkg -i packages-microsoft-prod.deb
rm packages-microsoft-prod.deb
<button class="d-button">אשר כניסה למסך מלא</button>
<script>
document.querySelector('.d-button').addEventListener('click', function() {
  var elem = document.documentElement;
  if (elem.requestFullscreen) {
    elem.requestFullscreen();
  } else if (elem.mozRequestFullScreen) { /* Firefox */
    elem.mozRequestFullScreen();
  } else if (elem.webkitRequestFullscreen) { /* Chrome, Safari and Opera */
    elem.webkitRequestFullscreen();
  } else if (elem.msRequestFullscreen) { /* IE/Edge */
    elem.msRequestFullscreen();
  }
});
</script>
// A JavaScript module for submitting forms via AJAX

// This module depends on jQuery and the jQuery Form Plugin

var FormSubmission = {

  // Class to add to elements with form errors

  formErrorClass: 'form-error',

  // Adds form errors to the DOM

  appendFormErrors: function(data, form) {

    // Loop through the error data object

    for (var key in data) {

      // Create a new span element for the error message

      var error = $(document.createElement('span')).attr('class', FormSubmission.formErrorClass).text(data[key]);

      // Insert the error message before the input field with the corresponding name

      form.find("input[name='" + key + "']").before(error);

    }

  },

  // Hides the closest modal element to the given form

  closeModal: function(form) {

    form.closest('.modal').modal('hide');

  },

  // Handles the response from the form submission

  postFormSubmission: function(form, isModal, data) {

    // Remove any existing form errors

    FormSubmission.removeFormErrors(form);

    // If the form was submitted successfully

    if (data['success'] == true) {

      // Reset the form and close the modal if it's a modal form

      FormSubmission.resetForm(form, isModal);

    } else {

      // Append the form errors to the DOM

      FormSubmission.appendFormErrors(data['errors'], form);

    }

  },

  // Removes form errors from the DOM

  removeFormErrors: function(form) {

    form.find('.' + FormSubmission.formErrorClass).remove();

  },

  // Calls resetForm with isModal set to false

  resetForm: function(form) {

    FormSubmission.resetForm(form, false);

  },

  // Resets the form and closes the modal if it's a modal form

  resetForm: function(form, isModal) {

    // Remove any existing form errors

    FormSubmission.removeFormErrors(form);

    // Reset the form

    form[0].reset();

    // If it's a modal form, close the modal

    if (isModal == true) {

      FormSubmission.closeModal(form);

    }

  },

  // Calls submitForm with isModal set to false

  submitForm: function(form) {

    FormSubmission.submitForm(form, false);

  },

  // Submits the form via AJAX

  submitForm: function(form, isModal) {

    var url = form.attr('action');

    // Make an AJAX request to the form's action URL

    $.ajax({

      method: "POST",

      url: url,

      data: form.serialize(),

      myForm: form,

      isModal: isModal,

      // Handle the response from the server

      success: function(data) {

        FormSubmission.postFormSubmission($(this).myForm, $(this).isModal, data);

      },

      // Handle any errors

      error: function(jqXHR, textStatus, errorThrown) {

        console.log(textStatus, errorThrown);

      }

    });

  },

  // Submits the form via AJAX with support for file uploads

  submitFormWithFiles: function(form, isModal) {

    var url = form.attr('action');

    // Make an AJAX request to the form's action URL with support for file uploads

    form.ajaxSubmit({

      method: 'POST',

      url: url,

      myForm: form,

      isModal: isModal,

      // Handle the response from the server

      success: function(data) {

        FormSubmission.postFormSubmission($(this).myForm, $(this).isModal, data);

      },

      //

sudo apt remove --purge emacs-bin-common emacs-el emacs-gtk
star

Sat Mar 18 2023 11:54:27 GMT+0000 (UTC)

@galiendev

star

Sat Mar 18 2023 11:27:09 GMT+0000 (UTC)

@MaazMohd

star

Sat Mar 18 2023 05:50:18 GMT+0000 (UTC) https://devsheet.com/code-snippet/python-check-nan-values-with-and-without-using-packages/

@xvmodvx #python

star

Sat Mar 18 2023 03:05:34 GMT+0000 (UTC) https://stackoverflow.com/questions/29955500/code-is-not-working-in-on-the-command-line-for-visual-studio-code-on-os-x-ma

@Gimnath

star

Fri Mar 17 2023 22:12:00 GMT+0000 (UTC) my school

@nova

star

Fri Mar 17 2023 20:33:19 GMT+0000 (UTC) https://www.geeksforgeeks.org/python-convert-string-dictionary-to-dictionary/

@DiegoEraso #python

star

Fri Mar 17 2023 19:37:25 GMT+0000 (UTC)

@solve_karbe12 #c

star

Fri Mar 17 2023 19:21:51 GMT+0000 (UTC) https://tealfeed.com/build-simple-star-rating-system-swohq

@Anzelmo

star

Fri Mar 17 2023 18:34:52 GMT+0000 (UTC)

@samee

star

Fri Mar 17 2023 17:30:56 GMT+0000 (UTC)

@solve_karbe12 #c

star

Fri Mar 17 2023 16:55:04 GMT+0000 (UTC)

@Oscarsa3

star

Fri Mar 17 2023 16:48:03 GMT+0000 (UTC)

@romanxteo

star

Fri Mar 17 2023 16:47:32 GMT+0000 (UTC)

@romanxteo

star

Fri Mar 17 2023 16:41:33 GMT+0000 (UTC) https://www.codingninjas.com/codestudio/problems/dfs-traversal_630462?leftPanelTab=0

@Ranjan_kumar #c++

star

Fri Mar 17 2023 16:14:11 GMT+0000 (UTC) https://stackoverflow.com/questions/72117276/how-to-properly-use-fontawesome-on-react-js

@Jaimin047 #react #react.js #fontawosome

star

Fri Mar 17 2023 15:37:00 GMT+0000 (UTC)

@artemka

star

Fri Mar 17 2023 15:36:16 GMT+0000 (UTC)

@artemka

star

Fri Mar 17 2023 15:30:02 GMT+0000 (UTC)

@Roelinde

star

Fri Mar 17 2023 15:19:21 GMT+0000 (UTC) http://bio.gsi.de/DOCS/NCDWARE/V5.0.000/HTML/term_em8.htm

@D_GEIGER

star

Fri Mar 17 2023 15:17:33 GMT+0000 (UTC) https://social.technet.microsoft.com/Forums/en-US/1e5064fa-325d-4bb0-b6dd-bf30fea9f63f/scsm-exchange-connector-not-parsing?forum

@D_GEIGER

star

Fri Mar 17 2023 14:11:38 GMT+0000 (UTC) https://www.codingninjas.com/codestudio/problems/bfs-in-graph_973002

@Ranjan_kumar #c++

star

Fri Mar 17 2023 13:31:30 GMT+0000 (UTC)

@QuinnFox12

star

Fri Mar 17 2023 13:09:57 GMT+0000 (UTC)

@zamorays

star

Fri Mar 17 2023 12:17:05 GMT+0000 (UTC) https://learnxinyminutes.com/docs/python/

@Rmin

star

Fri Mar 17 2023 11:47:09 GMT+0000 (UTC) https://1stwebdesigner.com/css-basics-visibility-hidden-vs-display-none/

@Sebhart #css #layout

star

Fri Mar 17 2023 11:31:17 GMT+0000 (UTC) https://wpjohnny.com/custom-log-out-link-without-confirmation/

@fossan

star

Fri Mar 17 2023 10:39:45 GMT+0000 (UTC) https://stackoverflow.com/questions/827371/is-there-a-way-to-list-all-the-available-windows-drives

@yusufalao #python

star

Fri Mar 17 2023 08:28:14 GMT+0000 (UTC) https://websites.godaddy.com/en-US/editor/0ad8ad13-b5aa-4756-bcba-6d1770679572/44c7adb5-9e8e-40fb-8e7b-8b2bdfa06fa6/edit

@Vkmartinez95

star

Fri Mar 17 2023 08:27:06 GMT+0000 (UTC) https://websites.godaddy.com/en-US/editor/0ad8ad13-b5aa-4756-bcba-6d1770679572/44c7adb5-9e8e-40fb-8e7b-8b2bdfa06fa6/edit

@Vkmartinez95

star

Fri Mar 17 2023 07:34:27 GMT+0000 (UTC) https://practice.geeksforgeeks.org/problems/print-adjacency-list-1587115620/1

@Ranjan_kumar #c++

star

Fri Mar 17 2023 06:16:12 GMT+0000 (UTC)

@atharva36

star

Fri Mar 17 2023 05:21:04 GMT+0000 (UTC) https://drive.google.com/drive/u/0/folders/1jC_9AcPzP8kHmGULo5D9RHx1l9tiTjwe

@hasan1d2d

star

Fri Mar 17 2023 04:59:10 GMT+0000 (UTC) thetoptech.club

@leon.mueller

star

Fri Mar 17 2023 04:59:09 GMT+0000 (UTC) thetoptech.club

@leon.mueller

star

Fri Mar 17 2023 04:59:09 GMT+0000 (UTC) thetoptech.club

@leon.mueller

star

Fri Mar 17 2023 04:59:08 GMT+0000 (UTC) thetoptech.club

@leon.mueller

star

Fri Mar 17 2023 04:59:08 GMT+0000 (UTC) thetoptech.club

@leon.mueller

star

Fri Mar 17 2023 03:29:50 GMT+0000 (UTC)

@QuinnFox12

star

Thu Mar 16 2023 23:21:39 GMT+0000 (UTC)

@Fwedy #c++

star

Thu Mar 16 2023 22:32:52 GMT+0000 (UTC) https://wordpress.stackexchange.com/questions/26388/how-can-i-create-custom-url-routes

@dtholen

star

Thu Mar 16 2023 21:51:24 GMT+0000 (UTC) https://learn.microsoft.com/nl-nl/dotnet/core/install/linux-debian?source

@Anzelmo

star

Thu Mar 16 2023 21:51:00 GMT+0000 (UTC) https://learn.microsoft.com/nl-nl/dotnet/core/install/linux-debian?source

@Anzelmo

star

Thu Mar 16 2023 21:50:35 GMT+0000 (UTC) https://learn.microsoft.com/nl-nl/dotnet/core/install/linux-debian?source

@Anzelmo

star

Thu Mar 16 2023 21:50:21 GMT+0000 (UTC) https://learn.microsoft.com/nl-nl/dotnet/core/install/linux-debian?source

@Anzelmo

star

Thu Mar 16 2023 20:57:34 GMT+0000 (UTC) https://chat.openai.com/chat

@sbi2022

star

Thu Mar 16 2023 19:48:35 GMT+0000 (UTC)

@khalidlogi #php

star

Thu Mar 16 2023 18:21:03 GMT+0000 (UTC) https://stackoverflow.com/questions/57895073/how-remove-emacs-full

@challow #lisp

Save snippets that work with our extensions

Available in the Chrome Web Store Get Firefox Add-on Get VS Code extension